Govenor Greta Crypto Dog - Mix of Grey Wolf, Corgi, Husky and Labrador BK
Govenor Greta
  • Purity 21%
  • Age 5 months
  • Racing Exp 0
  • Grey Wolf 36%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Ecstatic & Fast

Achievements

None

Bio

I'm not into dog collars, unless you're into S & M. I love fetching anything my human throws! My humans say I slobber too much, but hey, I'm just juicy. My favorite song is "Who Let the Dogs Out?" It was me :)

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: CCCAGCAGCCCCCCCACACCCGCAACAAGCACA
C
C
C
A
G
C
A
G
C
C
C
C
C
C
C
A
C
A
C
C
C
G
C
A
A
C
A
A
G
C
A
C
A
Genes: LOOLL4L64O4

Composition

Grey Wolf
36%
Corgi
27%
Husky
27%
Labrador BK
9%

Current Energy

Vitality -15 points
Lunar Effect -2 points

Traits Breakdown

Body Grey Wolf
Tail Corgi
Legs Corgi
Front Legs Grey Wolf
Head Grey Wolf
Ears Husky
Snout Grey Wolf
Mouth Labrador BK
Nose Husky
Eyes Corgi
Color Husky

Parents

No Children

Gift