Tiger Tommy-Boy Cryptocurrency Game Dog - Mix of Dachshund, Labrador BK, German Shepard, Rottweiler, French Bulldog, Shiba Inu, Pug, Corgi, Pitbull terrier and Husky
Tiger Tommy-Boy
  • Purity 1%
  • Age 3 months
  • Racing Exp 21
  • Dachshund 18%
  • Gold medal 1 Silver medal 0 Bronze medal 2
  • 4 races
  • Gen 1
Depressed & Snaillike

Achievements

Racer

Bio

Hello, I be Tiger Tommy-Boy. My favorite place to sleep is under the covers between my humans. I'm not into dog collars, unless you're into S & M. I enjoy finding and eating frozen cat turds in the winter. Bon appétit! I am not above stealing food off humans' plates.

Racing Stats

Ran 4 races
  • 1 0 2
 Best Time15.30 sec
No rank  Racing *** LTC
75.0 % wins (3) Breeding *** LTC
Scheduled races 0 Total *** LTC

DNA Analysis

DNA Sequence: GCATCACACCGAGTAGAAAGCGGATCCACAGGA
G
C
A
T
C
A
C
A
C
C
G
A
G
T
A
G
A
A
A
G
C
G
G
A
T
C
C
A
C
A
G
G
A
Genes: 67H9E2OAN4A

Composition

Dachshund
18%
Labrador BK
9%
German Shepard
9%
Rottweiler
9%
French Bulldog
9%
Shiba Inu
9%
Pug
9%
Corgi
9%
Pitbull terrier
9%
Husky
9%

Current Energy

Vitality -21 points
Lunar Effect +8 points

Traits Breakdown

Body Labrador BK
Tail German Shepard
Legs Rottweiler
Front Legs French Bulldog
Head Shiba Inu
Ears Pug
Snout Corgi
Mouth Dachshund
Nose Pitbull terrier
Eyes Husky
Color Dachshund