Rynn Rolls Royce Digital Cryptocurrency Dog - Mix of Grey Wolf, Beagle, Schnauzer, Yorkshire Terrier, Rottweiler, St. Bernard, Corgi, Golder Retriever, Labrador and Labrador BK
Rynn Rolls Royce
  • Purity 1%
  • Age 5 months
  • Racing Exp 1
  • Grey Wolf 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 1 races
  • Gen 0
Depressed & Snaillike

Achievements

Racer

Bio

Who's a good dog? Hopefully you! Rynn Rolls Royce here. I keep my well-built figure with zeros and ones. It turns me on when I can show an older dog a new trick. I'm totally against baths! They are the worst! Eat, sleep, poop. Honey, I've got it made.

Racing Stats

Ran 1 races
  • 0 0 0
 Best Time15.53 sec
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: CTAATATTACACCCCTGAAGCAGACCAGCACCC
C
T
A
A
T
A
T
T
A
C
A
C
C
C
C
T
G
A
A
G
C
A
G
A
C
C
A
G
C
A
C
C
C
Genes: DCFHLBO856L

Composition

Grey Wolf
18%
Beagle
9%
Schnauzer
9%
Yorkshire Terrier
9%
Rottweiler
9%
St. Bernard
9%
Corgi
9%
Golder Retriever
9%
Labrador
9%
Labrador BK
9%

Current Energy

Vitality -37 points
Lunar Effect +2 points

Traits Breakdown

Body Beagle
Tail Schnauzer
Legs Yorkshire Terrier
Front Legs Rottweiler
Head Grey Wolf
Ears St. Bernard
Snout Corgi
Mouth Golder Retriever
Nose Labrador
Eyes Labrador BK
Color Grey Wolf