Uggie Uhura Litecoin Dog - Mix of Labrador, Dachshund, Pug, Boxer, Beagle, Schnauzer, Husky, Maltese, Grey Wolf and Labrador BK
Uggie Uhura
  • Purity 1%
  • Age 13 months
  • Racing Exp 0
  • Labrador 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Sad & Tardy

Achievements

None

Bio

I don't like it when my bowl is empty, so I take it to my human and it magically refills! I like to eat. Anything and everything. Old or new. My stomach doesn't discriminate! I adore sleeping upside down with my tongue hanging out! Ultimate Frisbee is my favorite sport. I haven't really mastered the throwing part yet, but I have the catching part down!

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: GGACCAGAACCAAACCTAATAACAACCCCCGCA
G
G
A
C
C
A
G
A
A
C
C
A
A
A
C
C
T
A
A
T
A
A
C
A
A
C
C
C
C
C
G
C
A
Genes: A525GDC4KL6

Composition

Labrador
18%
Dachshund
9%
Pug
9%
Boxer
9%
Beagle
9%
Schnauzer
9%
Husky
9%
Maltese
9%
Grey Wolf
9%
Labrador BK
9%

Current Energy

Vitality -53 points
Lunar Effect 0 points

Traits Breakdown

Body Dachshund
Tail Labrador
Legs Pug
Front Legs Labrador
Head Boxer
Ears Beagle
Snout Schnauzer
Mouth Husky
Nose Maltese
Eyes Grey Wolf
Color Labrador BK

Parents

No Children

Gift