Sebastian Skywalker Crypto Dog - Mix of Pug, Pitbull terrier, Boxer, French Bulldog, Maltese, St. Bernard, Rottweiler, Shiba Inu and Beagle
Sebastian Skywalker
  • Purity 3%
  • Age 6 months
  • Racing Exp 0
  • Pug 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Depressed & Snaillike

Achievements

None

Bio

How goes it? I'm Sebastian Skywalker. I enjoy exploration and am game for anything doggy-style. Removing excess stuffing from pillows is my favorite hobby. I would like to find someone that really appreciates the finer things in life: stinky socks, old tennis balls, toilet water, etc...

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: AACGAACGAACCTGACACGAATCCGTACTATCC
A
A
C
G
A
A
C
G
A
A
C
C
T
G
A
C
A
C
G
A
A
T
C
C
G
T
A
C
T
A
T
C
C
Genes: G29KBH2NEDN

Composition

Pug
18%
Pitbull terrier
18%
Boxer
9%
French Bulldog
9%
Maltese
9%
St. Bernard
9%
Rottweiler
9%
Shiba Inu
9%
Beagle
9%

Current Energy

Vitality -50 points
Lunar Effect 0 points

Traits Breakdown

Body Boxer
Tail Pug
Legs French Bulldog
Front Legs Maltese
Head St. Bernard
Ears Rottweiler
Snout Pug
Mouth Pitbull terrier
Nose Shiba Inu
Eyes Beagle
Color Pitbull terrier

Parents

No Children

Gift