Dempsey Dozer Litecoin Dog - Mix of St. Bernard, Dachshund, Maltese, Border Collie, Golder Retriever, Husky and Labrador
Dempsey Dozer
  • Purity 16%
  • Age 5 months
  • Racing Exp 0
  • St. Bernard 36%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Depressed & Snaillike

Achievements

None

Bio

Ima Ethernet dog. I wish my human would stop putting clothes on me. Don't try to cover my flawless fur! I like never worrying about my dog poo. I've got people for that. I never met a crotch or a butt I didn't like, but I'm just friendly that way. Steak is my absolute favorite, but I prefer to eat chicken for my health.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: GGAGGAACCTACAGATGATGAACACCATGATGA
G
G
A
G
G
A
A
C
C
T
A
C
A
G
A
T
G
A
T
G
A
A
C
A
C
C
A
T
G
A
T
G
A
Genes: AAKJ8BB45BB

Composition

St. Bernard
36%
Dachshund
18%
Maltese
9%
Border Collie
9%
Golder Retriever
9%
Husky
9%
Labrador
9%

Current Energy

Vitality -44 points
Lunar Effect +10 points

Traits Breakdown

Body Dachshund
Tail Dachshund
Legs Maltese
Front Legs Border Collie
Head Golder Retriever
Ears St. Bernard
Snout St. Bernard
Mouth Husky
Nose Labrador
Eyes St. Bernard
Color St. Bernard