Santa Paws Simon Crypto Game Dog - Mix of Golder Retriever, Dachshund, Poodle, Labrador BK, Pug, Schnauzer, Border Collie and St. Bernard
Santa Paws Simon
  • Purity 8%
  • Age 17 months
  • Racing Exp 0
  • Golder Retriever 27%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Neutral & Casual

Achievements

None

Bio

Whatcha know, honey. Santa Paws Simon here. Fences are just challenges...I don't let them stop me! My favorite way to spend playtime is a good game of frisbee. I'm sick of having my nails clipped, those are to help me dig! As a perfectionist, I have to find just the right 'spot'.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: GGAGACAGAGCAAGAGAAATATACAGATGAGGA
G
G
A
G
A
C
A
G
A
G
C
A
A
G
A
G
A
A
A
T
A
T
A
C
A
G
A
T
G
A
G
G
A
Genes: AI8682CJ8BA

Composition

Golder Retriever
27%
Dachshund
18%
Poodle
9%
Labrador BK
9%
Pug
9%
Schnauzer
9%
Border Collie
9%
St. Bernard
9%

Current Energy

Vitality -31 points
Lunar Effect -10 points

Traits Breakdown

Body Dachshund
Tail Poodle
Legs Golder Retriever
Front Legs Labrador BK
Head Golder Retriever
Ears Pug
Snout Schnauzer
Mouth Border Collie
Nose Golder Retriever
Eyes St. Bernard
Color Dachshund