Commando Charles Bitcoin Dog - Mix of Schnauzer, Pitbull terrier, Maltese, Poodle, Corgi, Yorkshire Terrier, Rottweiler, Border Collie and French Bulldog
Commando Charles
  • Purity 3%
  • Age 13 months
  • Racing Exp 14
  • Schnauzer 18%
  • Gold medal 0 Silver medal 2 Bronze medal 0
  • 2 races
  • Gen 0
Sad & Tardy

Achievements

Racer

Bio

If you have fleas or ticks, don't bother. My human's feet are definitely the greatest smell ever. Especially after a long day at work! Fences are just challenges...I don't let them stop me! I love licking faces! Little humans are my favorite because they usually have some good food smeared all over them!

Racing Stats

Ran 2 races
  • 0 2 0
 Best Time14.85 sec
No rank  RacingĀ *** LTC
100.0 % wins (2) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: ACCATAGACTCCAGCTTACACTACTCCCGAATA
A
C
C
A
T
A
G
A
C
T
C
C
A
G
C
T
T
A
C
A
C
T
A
C
T
C
C
C
G
A
A
T
A
Genes: KCINOFHJN9C

Composition

Schnauzer
18%
Pitbull terrier
18%
Maltese
9%
Poodle
9%
Corgi
9%
Yorkshire Terrier
9%
Rottweiler
9%
Border Collie
9%
French Bulldog
9%

Current Energy

Vitality -57 points
Lunar Effect +2 points

Traits Breakdown

Body Maltese
Tail Schnauzer
Legs Poodle
Front Legs Pitbull terrier
Head Corgi
Ears Yorkshire Terrier
Snout Rottweiler
Mouth Border Collie
Nose Pitbull terrier
Eyes French Bulldog
Color Schnauzer