Misha Montana Crypto Dog - Mix of Golder Retriever, Labrador BK, Shiba Inu, Husky, Corgi, Schnauzer, Border Collie, Grey Wolf, Boxer and Rottweiler
Misha Montana
  • Purity 3%
  • Age 9 months
  • Racing Exp 10
  • Golder Retriever 18%
  • Gold medal 1 Silver medal 0 Bronze medal 0
  • 3 races
  • Gen 0
Depressed & Snaillike

Achievements

Racer

Bio

Hey, Baby. I'm Misha Montana. I run with a pack in the data warehouse. Fences are just challenges...I don't let them stop me! Forget plastic hotdogs...I'm into the classic chew toys like slippers. I could spend days on end chasing my tail. I get so close but it's just so fast! I 'm here for something RUFF ;)

Racing Stats

Ran 3 races
  • 1 0 0
 Best Time14.67 sec
No rank  RacingĀ *** LTC
33.3 % wins (1) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: GCAGTAAGAAGAACAAGCATATACCCCAACCAC
G
C
A
G
T
A
A
G
A
A
G
A
A
C
A
A
G
C
A
T
A
T
A
C
C
C
C
A
A
C
C
A
C
Genes: 6E884OCJLGH

Composition

Golder Retriever
18%
Labrador BK
9%
Shiba Inu
9%
Husky
9%
Corgi
9%
Schnauzer
9%
Border Collie
9%
Grey Wolf
9%
Boxer
9%
Rottweiler
9%

Current Energy

Vitality -12 points
Lunar Effect -6 points

Traits Breakdown

Body Labrador BK
Tail Shiba Inu
Legs Golder Retriever
Front Legs Golder Retriever
Head Husky
Ears Corgi
Snout Schnauzer
Mouth Border Collie
Nose Grey Wolf
Eyes Boxer
Color Rottweiler