Bobo Bean Bitcoin Dog - Mix of Poodle, Pug, Rottweiler, Boxer, Golder Retriever, Labrador, Maltese, German Shepard and Husky
Bobo Bean
  • Purity 3%
  • Age 11 months
  • Racing Exp 0
  • Poodle 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Ecstatic & Fast

Achievements

None

Bio

I'm Bobo Bean. How goes it? I don't appreciate being around bores who bark too much. My favorite song is "Who Let the Dogs Out?" It was me :) I'm tired of barking up the wrong trees! Seriously, my ball is stuck in a tree and I need someone to help me get it...

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: CACGACAACAGACCAGAAACCGACGAATCAACA
C
A
C
G
A
C
A
A
C
A
G
A
C
C
A
G
A
A
A
C
C
G
A
C
G
A
A
T
C
A
A
C
A
Genes: HIG852KI274

Composition

Poodle
18%
Pug
18%
Rottweiler
9%
Boxer
9%
Golder Retriever
9%
Labrador
9%
Maltese
9%
German Shepard
9%
Husky
9%

Current Energy

Vitality -42 points
Lunar Effect -6 points

Traits Breakdown

Body Rottweiler
Tail Poodle
Legs Boxer
Front Legs Golder Retriever
Head Labrador
Ears Pug
Snout Maltese
Mouth Poodle
Nose Pug
Eyes German Shepard
Color Husky

Parents

No Children

Gift