Zelda Zane Litecoin Dog - Mix of Border Collie, Labrador, Maltese, Dachshund, Pitbull terrier, Labrador BK, Pug and Corgi
Zelda Zane
  • Purity 8%
  • Age 5 months
  • Racing Exp 1
  • Border Collie 27%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 1 races
  • Gen 0
Depressed & Snaillike

Achievements

Racer

Bio

I'm Zelda Zane and I'd like to show you a trick or two. I like never worrying about my dog poo. I've got people for that. I cry whenever I hear an ambulance siren! You know the worst? Watching my humans 'get it on' and I have to lick myself. I'm a gourmand...my favorite dish is that dry food that makes it's own gravy!

Racing Stats

Ran 1 races
  • 0 0 0
 Best Time15.77 sec
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TACACCGGATACTCCCCACCATACGCAGAAAGC
T
A
C
A
C
C
G
G
A
T
A
C
T
C
C
C
C
A
C
C
A
T
A
C
G
C
A
G
A
A
A
G
C
Genes: JKAJN55J62O

Composition

Border Collie
27%
Labrador
18%
Maltese
9%
Dachshund
9%
Pitbull terrier
9%
Labrador BK
9%
Pug
9%
Corgi
9%

Current Energy

Vitality -32 points
Lunar Effect -4 points

Traits Breakdown

Body Border Collie
Tail Maltese
Legs Dachshund
Front Legs Border Collie
Head Pitbull terrier
Ears Labrador
Snout Labrador
Mouth Border Collie
Nose Labrador BK
Eyes Pug
Color Corgi

Parents

Children

Photos

Gift