Molly Mister Miyagi Crypto Game Dog - Mix of Poodle, Pitbull terrier, French Bulldog, Shiba Inu, Golder Retriever, Labrador BK, Maltese, Beagle, Yorkshire Terrier and Schnauzer
Molly Mister Miyagi
  • Purity 1%
  • Age 3 months
  • Racing Exp 0
  • Poodle 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Depressed & Snaillike

Achievements

None

Bio

I live in cyberspace where you can turn me on. I prefer lounging around the house. Nothing beats the midday sunbeam on the couch! Chasing anything that will run is so much fun, I could do that all day. If we can run as a pack for a while, I'm open to that.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TCCCGAGTAGACAGAGCAGACACCCTATTAATA
T
C
C
C
G
A
G
T
A
G
A
C
A
G
A
G
C
A
G
A
C
A
C
C
C
T
A
T
T
A
A
T
A
Genes: N9EI86IKDFC

Composition

Poodle
18%
Pitbull terrier
9%
French Bulldog
9%
Shiba Inu
9%
Golder Retriever
9%
Labrador BK
9%
Maltese
9%
Beagle
9%
Yorkshire Terrier
9%
Schnauzer
9%

Current Energy

Vitality -31 points
Lunar Effect -10 points

Traits Breakdown

Body Pitbull terrier
Tail French Bulldog
Legs Shiba Inu
Front Legs Poodle
Head Golder Retriever
Ears Labrador BK
Snout Poodle
Mouth Maltese
Nose Beagle
Eyes Yorkshire Terrier
Color Schnauzer

Parents

No Children

Gift