Lili Lizzy Cryptocurrency Game Dog - Mix of Pitbull terrier, Pug, Border Collie, Labrador, Labrador BK, St. Bernard, Husky, Schnauzer and Rottweiler
Lili Lizzy
  • Purity 3%
  • Age 11 months
  • Racing Exp 0
  • Pitbull terrier 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Depressed & Snaillike

Achievements

None

Bio

Salutations! My name's Lili Lizzy. Halloween costumes are the worst, I hate 'em! I love it when you show a little teeth. Slipping my collar, running off and making my humans worried? Every chance I get. I'm trying to find a partner in crime to help me dig through the trash for the good stuff.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TACTCCGAACCATCCGCAGAATGAACAATACAC
T
A
C
T
C
C
G
A
A
C
C
A
T
C
C
G
C
A
G
A
A
T
G
A
A
C
A
A
T
A
C
A
C
Genes: JN25N62B4CH

Composition

Pitbull terrier
18%
Pug
18%
Border Collie
9%
Labrador
9%
Labrador BK
9%
St. Bernard
9%
Husky
9%
Schnauzer
9%
Rottweiler
9%

Current Energy

Vitality -42 points
Lunar Effect +8 points

Traits Breakdown

Body Border Collie
Tail Pitbull terrier
Legs Pug
Front Legs Labrador
Head Pitbull terrier
Ears Labrador BK
Snout Pug
Mouth St. Bernard
Nose Husky
Eyes Schnauzer
Color Rottweiler

Parents

No Children

Gift