Benny Buddy Boy Litecoin Dog - Mix of German Shepard, Rottweiler, Maltese, Yorkshire Terrier, Corgi, French Bulldog and Dachshund
Benny Buddy Boy
  • Purity 8%
  • Age 3 months
  • Racing Exp 0
  • German Shepard 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Depressed & Snaillike

Achievements

None

Bio

I hate it when humans put the lid down. I love connecting with my friends via pee-mail. My humans say I slobber too much, but hey, I'm just juicy. What's your favorite bed? Mine is the dirty laundry. I'm looking for someone smart enough to help me find the treat stash.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: AGCTCATCACGACACACCTTAGGAACCTTACAC
A
G
C
T
C
A
T
C
A
C
G
A
C
A
C
A
C
C
T
T
A
G
G
A
A
C
C
T
T
A
C
A
C
Genes: O779HKFAKFH

Composition

German Shepard
18%
Rottweiler
18%
Maltese
18%
Yorkshire Terrier
18%
Corgi
9%
French Bulldog
9%
Dachshund
9%

Current Energy

Vitality -30 points
Lunar Effect 0 points

Traits Breakdown

Body Corgi
Tail German Shepard
Legs German Shepard
Front Legs French Bulldog
Head Rottweiler
Ears Maltese
Snout Yorkshire Terrier
Mouth Dachshund
Nose Maltese
Eyes Yorkshire Terrier
Color Rottweiler

Parents

No Children

Gift