Banjo Birdy Cryptocurrency Dog - Mix of Corgi, Labrador, Golder Retriever, Border Collie, Maltese, German Shepard, Schnauzer and Labrador BK
Banjo Birdy
  • Purity 8%
  • Age 3 months
  • Racing Exp 0
  • Corgi 27%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Depressed & Snaillike

Achievements

None

Bio

Hey there... I'm Banjo Birdy. You can access my database anytime with your WiFi. Rolling around on the carpet after a bath is my favorite way to dry. If I can't reach it to clean it myself, it doesn't need cleaning! Don't bother contacting me if you like cats.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: AGAAGCCCATACACCTCAAGCAGCATACCAGCA
A
G
A
A
G
C
C
C
A
T
A
C
A
C
C
T
C
A
A
G
C
A
G
C
A
T
A
C
C
A
G
C
A
Genes: 8O5JK7OOC56

Composition

Corgi
27%
Labrador
18%
Golder Retriever
9%
Border Collie
9%
Maltese
9%
German Shepard
9%
Schnauzer
9%
Labrador BK
9%

Current Energy

Vitality -24 points
Lunar Effect +10 points

Traits Breakdown

Body Golder Retriever
Tail Corgi
Legs Labrador
Front Legs Border Collie
Head Maltese
Ears German Shepard
Snout Corgi
Mouth Corgi
Nose Schnauzer
Eyes Labrador
Color Labrador BK