Rex Rikimaru Bitcoin Game Dog - Mix of Poodle, Border Collie, Shiba Inu, Husky, German Shepard, Beagle, Corgi, Schnauzer and Pug
Rex Rikimaru
  • Purity 5%
  • Age 5 months
  • Racing Exp 0
  • Poodle 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Depressed & Snaillike

Achievements

None

Bio

This dawg chases mice in a big data warehouse. Blue toilet water turns me off. I love connecting with my friends via pee-mail. Steak is my absolute favorite, but I prefer to eat chicken for my health. Oh, go ahead. Pet me. I know you want to.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: GTAGACACATCATACTACCTAGACAGCATAGAA
G
T
A
G
A
C
A
C
A
T
C
A
T
A
C
T
A
C
C
T
A
G
A
C
A
G
C
A
T
A
G
A
A
Genes: EI47JJDIOC2

Composition

Poodle
18%
Border Collie
18%
Shiba Inu
9%
Husky
9%
German Shepard
9%
Beagle
9%
Corgi
9%
Schnauzer
9%
Pug
9%

Current Energy

Vitality -12 points
Lunar Effect +2 points

Traits Breakdown

Body Shiba Inu
Tail Poodle
Legs Husky
Front Legs German Shepard
Head Border Collie
Ears Border Collie
Snout Beagle
Mouth Poodle
Nose Corgi
Eyes Schnauzer
Color Pug

Parents

No Children

Gift