Klaus Khloe Crypto Dog - Mix of Shiba Inu, Golder Retriever, St. Bernard, Labrador, Corgi, Maltese, Pug and Rottweiler
Klaus Khloe
  • Purity 6%
  • Age 9 months
  • Racing Exp 0
  • Shiba Inu 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Depressed & Snaillike

Achievements

None

Bio

Let me introduce myself, I'm Klaus Khloe. I've had my nose rubbed in 'it' more than once. In my humble opinion the best toy is one of my human's stinky, old socks. Let me have a pig's ear and I'm in heaven. I hate squeaky toys...when I finally get one to stop making that awful sound, my human buys another! I just want to "share a bone"... ;)

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: CCAAGCGTAAGAACCAGAGAACACTGATGAGTA
C
C
A
A
G
C
G
T
A
A
G
A
A
C
C
A
G
A
G
A
A
C
A
C
T
G
A
T
G
A
G
T
A
Genes: 5OE8K82HBBE

Composition

Shiba Inu
18%
Golder Retriever
18%
St. Bernard
18%
Labrador
9%
Corgi
9%
Maltese
9%
Pug
9%
Rottweiler
9%

Current Energy

Vitality -25 points
Lunar Effect +2 points

Traits Breakdown

Body Labrador
Tail Corgi
Legs Shiba Inu
Front Legs Golder Retriever
Head Maltese
Ears Golder Retriever
Snout Pug
Mouth Rottweiler
Nose St. Bernard
Eyes St. Bernard
Color Shiba Inu