Nani Nellie Bitcoin Dog - Mix of Corgi, Labrador, Husky, Shiba Inu, Rottweiler, Dachshund, Border Collie, Beagle and Schnauzer
Nani Nellie
  • Purity 3%
  • Age 7 months
  • Racing Exp 0
  • Corgi 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Depressed & Snaillike

Achievements

None

Bio

The Ethernet where I live, rocks. I cry whenever I hear an ambulance siren! I really dislike when my humans leave the house. Where could they possibly go that's better than my wonderful house? If you are tall enough to reach the door handle, I 'specially wanna meet you.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: ACAGTAAGCCACGGAAGCCCATACCTACCAATA
A
C
A
G
T
A
A
G
C
C
A
C
G
G
A
A
G
C
C
C
A
T
A
C
C
T
A
C
C
A
A
T
A
Genes: 4EOHAO5JD5C

Composition

Corgi
18%
Labrador
18%
Husky
9%
Shiba Inu
9%
Rottweiler
9%
Dachshund
9%
Border Collie
9%
Beagle
9%
Schnauzer
9%

Current Energy

Vitality -35 points
Lunar Effect +2 points

Traits Breakdown

Body Husky
Tail Shiba Inu
Legs Corgi
Front Legs Rottweiler
Head Dachshund
Ears Corgi
Snout Labrador
Mouth Border Collie
Nose Beagle
Eyes Labrador
Color Schnauzer

Parents

No Children

Gift