Butternut Barbie Crypto Game Dog - Mix of Corgi, Husky, French Bulldog, Maltese, Labrador, Dachshund, Yorkshire Terrier, Labrador BK and Poodle
Butternut Barbie
  • Purity 3%
  • Age 15 months
  • Racing Exp 0
  • Corgi 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Neutral & Lazy

Achievements

None

Bio

Howdy! I'm Butternut Barbie. I enjoy destroying a nice fresh pair of slippers. I'll lick anything. My favorite thing is to sit in my humans' laps while they are trying to read or drive. Ever play 'catch' with two humans then it turns into 'keep away'? Hate that.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: CGAAGCACAACCCCAGGATTAGCAGACACAAGC
C
G
A
A
G
C
A
C
A
A
C
C
C
C
A
G
G
A
T
T
A
G
C
A
G
A
C
A
C
A
A
G
C
Genes: 9O4K5AF6I4O

Composition

Corgi
18%
Husky
18%
French Bulldog
9%
Maltese
9%
Labrador
9%
Dachshund
9%
Yorkshire Terrier
9%
Labrador BK
9%
Poodle
9%

Current Energy

Vitality -40 points
Lunar Effect -8 points

Traits Breakdown

Body French Bulldog
Tail Corgi
Legs Husky
Front Legs Maltese
Head Labrador
Ears Dachshund
Snout Yorkshire Terrier
Mouth Labrador BK
Nose Poodle
Eyes Husky
Color Corgi

Parents

No Children

Gift