Dots Darlene Bitcoin Dog - Mix of Yorkshire Terrier, St. Bernard, Rottweiler, Pitbull terrier, Corgi, Border Collie, Labrador BK and Pug
Dots Darlene
  • Purity 8%
  • Age 7 months
  • Racing Exp 6
  • Yorkshire Terrier 18%
  • Gold medal 0 Silver medal 0 Bronze medal 1
  • 1 races
  • Gen 0
Depressed & Snaillike

Achievements

Racer

Bio

I live in cyberspace where you can turn me on. I hate going to the vet and will do almost anything to avoid it. If you enjoy growling through fences as much as I do, we should get together. I just want the simple things in life. A warm bed, a full food bowl, and a nice butt to sniff.

Racing Stats

Ran 1 races
  • 0 0 1
 Best Time16.92 sec
No rank  RacingĀ *** LTC
100.0 % wins (1) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TCCTTAAGCTACGCATGATGACACCACGAATTA
T
C
C
T
T
A
A
G
C
T
A
C
G
C
A
T
G
A
T
G
A
C
A
C
C
A
C
G
A
A
T
T
A
Genes: NFOJ6BBHH2F

Composition

Yorkshire Terrier
18%
St. Bernard
18%
Rottweiler
18%
Pitbull terrier
9%
Corgi
9%
Border Collie
9%
Labrador BK
9%
Pug
9%

Current Energy

Vitality -33 points
Lunar Effect -2 points

Traits Breakdown

Body Pitbull terrier
Tail Yorkshire Terrier
Legs Corgi
Front Legs Border Collie
Head Labrador BK
Ears St. Bernard
Snout St. Bernard
Mouth Rottweiler
Nose Rottweiler
Eyes Pug
Color Yorkshire Terrier

Parents

No Children

Photos

Bitcoin dog racing photo
Gift