Sheeva Slater Litecoin Game Dog - Mix of Labrador BK, Schnauzer, Pug, Beagle, Yorkshire Terrier, Border Collie, Husky and Golder Retriever
Sheeva Slater
  • Purity 4%
  • Age 3 months
  • Racing Exp 0
  • Labrador BK 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Depressed & Snaillike

Achievements

None

Bio

What's up? I'm Sheeva Slater. Taking a break from chasing Nyan Cat around cyberspace. My human says I'm loyal, intelligent, devoted and affectionate. I have an ongoing battle with the vacuum cleaner. It's loud and it steals all the food crumbs I was saving for later! I'm trying to find a partner in crime to help me dig through the trash for the good stuff.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: CTAGCATTAATATACGCAATAACAGAAAGAGAA
C
T
A
G
C
A
T
T
A
A
T
A
T
A
C
G
C
A
A
T
A
A
C
A
G
A
A
A
G
A
G
A
A
Genes: D6FCJ6C4282

Composition

Labrador BK
18%
Schnauzer
18%
Pug
18%
Beagle
9%
Yorkshire Terrier
9%
Border Collie
9%
Husky
9%
Golder Retriever
9%

Current Energy

Vitality -23 points
Lunar Effect -4 points

Traits Breakdown

Body Beagle
Tail Labrador BK
Legs Yorkshire Terrier
Front Legs Schnauzer
Head Border Collie
Ears Labrador BK
Snout Schnauzer
Mouth Husky
Nose Pug
Eyes Golder Retriever
Color Pug

Parents

No Children

Gift