Rolls Royce Ringo Crypto Dog - Mix of Pug, Beagle, Labrador BK, Maltese, Golder Retriever, Poodle, Pitbull terrier, Schnauzer, St. Bernard and Corgi
Rolls Royce Ringo
  • Purity 1%
  • Age 4 months
  • Racing Exp 0
  • Pug 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Depressed & Snaillike

Achievements

None

Bio

Taking a break from chasing Nyan Cat around cyberspace. I'm into leather...if I have the right partner. I hate the mailman! He's always trying to sneak up on me, but I've got my eye on him! My favorite thing to do is go to the pet store with my human. All the other humans pet me and I get to pick out a new toy! I want a mate that knows how to give a proper belly rub!

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: CTAGCAACCAGAGACTCCATATGAGAAAGCGAA
C
T
A
G
C
A
A
C
C
A
G
A
G
A
C
T
C
C
A
T
A
T
G
A
G
A
A
A
G
C
G
A
A
Genes: D6K8INCB2O2

Composition

Pug
18%
Beagle
9%
Labrador BK
9%
Maltese
9%
Golder Retriever
9%
Poodle
9%
Pitbull terrier
9%
Schnauzer
9%
St. Bernard
9%
Corgi
9%

Current Energy

Vitality -54 points
Lunar Effect 0 points

Traits Breakdown

Body Beagle
Tail Labrador BK
Legs Maltese
Front Legs Golder Retriever
Head Poodle
Ears Pitbull terrier
Snout Schnauzer
Mouth St. Bernard
Nose Pug
Eyes Corgi
Color Pug

Parents

No Children

Gift