Spark Shasta Bitcoin Dog - Mix of Pug, Maltese, Labrador BK, Labrador, Shiba Inu, Rottweiler, Grey Wolf, Pitbull terrier and Schnauzer
Spark Shasta
  • Purity 6%
  • Age 3 months
  • Racing Exp 0
  • Pug 27%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Depressed & Snaillike

Achievements

None

Bio

Hey dawg! I'm Spark Shasta. I love the smell of freshly cut grass. I have a crush on the Grumpy cat. Steak is my absolute favorite, but I prefer to eat chicken for my health. Man, I hate it when my humans run out of my favorite food so all I get is 'dry' stuff. I've been solitary dog...looking for someone worth changing over.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: ACCGAAGAAGCACCAGTACACCCCGAATCCATA
A
C
C
G
A
A
G
A
A
G
C
A
C
C
A
G
T
A
C
A
C
C
C
C
G
A
A
T
C
C
A
T
A
Genes: K2265EHL2NC

Composition

Pug
27%
Maltese
9%
Labrador BK
9%
Labrador
9%
Shiba Inu
9%
Rottweiler
9%
Grey Wolf
9%
Pitbull terrier
9%
Schnauzer
9%

Current Energy

Vitality -31 points
Lunar Effect 0 points

Traits Breakdown

Body Maltese
Tail Pug
Legs Pug
Front Legs Labrador BK
Head Labrador
Ears Shiba Inu
Snout Rottweiler
Mouth Grey Wolf
Nose Pug
Eyes Pitbull terrier
Color Schnauzer

Parents

No Children

Gift