Nickie Newton Crypto Game Dog - Mix of Border Collie, Dachshund, Schnauzer, Labrador, Rottweiler, Boxer and Poodle
Nickie Newton
  • Purity 7%
  • Age 13 months
  • Racing Exp 2
  • Border Collie 27%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 2 races
  • Gen 0
Sad & Tardy

Achievements

Racer

Bio

I love digging. No particular reason, it just satisfies me to make a huge, muddy mess wherever I go. I don't understand why I like smelling butts... Air Bud is definitely my favorite movie. What a role model! I'm looking for someone smart enough to help me find the treat stash.

Racing Stats

Ran 2 races
  • 0 0 0
 Best Time16.30 sec
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: CCAGGACACTACATAAACATATACGGAGACTAC
C
C
A
G
G
A
C
A
C
T
A
C
A
T
A
A
A
C
A
T
A
T
A
C
G
G
A
G
A
C
T
A
C
Genes: 5AHJCGCJAIJ

Composition

Border Collie
27%
Dachshund
18%
Schnauzer
18%
Labrador
9%
Rottweiler
9%
Boxer
9%
Poodle
9%

Current Energy

Vitality -21 points
Lunar Effect 0 points

Traits Breakdown

Body Labrador
Tail Dachshund
Legs Rottweiler
Front Legs Border Collie
Head Schnauzer
Ears Boxer
Snout Schnauzer
Mouth Border Collie
Nose Dachshund
Eyes Poodle
Color Border Collie