Woofer Widget Bitcoin Game Dog - Mix of Golder Retriever, Schnauzer, Labrador, Beagle and Rottweiler
Woofer Widget
  • Purity 21%
  • Age 5 months
  • Racing Exp 0
  • Golder Retriever 45%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Depressed & Snaillike

Achievements

None

Bio

Nice to meet you! I'm Woofer Widget. My human's feet are definitely the greatest smell ever. Especially after a long day at work! I don't like to be ignored. My humans say I bark too much, but I have a lot to say! When I can break free, I enjoy exploring my neighborhood without my human.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: ATACCAAGAAGACTAAGACCAATACACAGAAGA
A
T
A
C
C
A
A
G
A
A
G
A
C
T
A
A
G
A
C
C
A
A
T
A
C
A
C
A
G
A
A
G
A
Genes: C588D85CH88

Composition

Golder Retriever
45%
Schnauzer
18%
Labrador
18%
Beagle
9%
Rottweiler
9%

Current Energy

Vitality -39 points
Lunar Effect +6 points

Traits Breakdown

Body Schnauzer
Tail Labrador
Legs Golder Retriever
Front Legs Golder Retriever
Head Beagle
Ears Golder Retriever
Snout Labrador
Mouth Schnauzer
Nose Rottweiler
Eyes Golder Retriever
Color Golder Retriever