Teddybear Trinity Bitcoin Dog - Mix of Poodle, German Shepard, Labrador BK, Maltese, Schnauzer, Pug, Corgi and Boxer
Teddybear Trinity
  • Purity 4%
  • Age 5 months
  • Racing Exp 0
  • Poodle 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Ecstatic & Fast

Achievements

None

Bio

How do you do? I'm Teddybear Trinity. Forget plastic hotdogs...I'm into the classic chew toys like slippers. When I can get it, my favorite meal is pepperoni pizza and Milk-Bones. I may need de-worming. I'm terrified of the big, loud, metal creature with people inside that picks up the trash every week. It's really scary!

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: GACACCATATCAGACGCAGAAGCATCAAGCAAC
G
A
C
A
C
C
A
T
A
T
C
A
G
A
C
G
C
A
G
A
A
G
C
A
T
C
A
A
G
C
A
A
C
Genes: IKC7I6267OG

Composition

Poodle
18%
German Shepard
18%
Labrador BK
18%
Maltese
9%
Schnauzer
9%
Pug
9%
Corgi
9%
Boxer
9%

Current Energy

Vitality -42 points
Lunar Effect -6 points

Traits Breakdown

Body Poodle
Tail Maltese
Legs Schnauzer
Front Legs German Shepard
Head Poodle
Ears Labrador BK
Snout Pug
Mouth Labrador BK
Nose German Shepard
Eyes Corgi
Color Boxer

Parents

No Children

Gift