Kong Karma Litecoin Dog - Mix of Maltese, Pitbull terrier, Beagle, Boxer, Rottweiler, Schnauzer, Pug, German Shepard and Yorkshire Terrier
Kong Karma
  • Purity 5%
  • Age 4 months
  • Racing Exp 0
  • Maltese 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Depressed & Snaillike

Achievements

None

Bio

Suh...you good? Kong Karma here. I love a good book... I find them quite tasty. I don't understand why I like smelling butts... My favorite pastime is playing tug-of-war with my human's underwear. I wish I never had to go to the vet's office. They are friendly enough, but it smells funny there.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: ACCTCCTCCCTAAACCACATAGAAACCTCATTA
A
C
C
T
C
C
T
C
C
C
T
A
A
A
C
C
A
C
A
T
A
G
A
A
A
C
C
T
C
A
T
T
A
Genes: KNNDGHC2K7F

Composition

Maltese
18%
Pitbull terrier
18%
Beagle
9%
Boxer
9%
Rottweiler
9%
Schnauzer
9%
Pug
9%
German Shepard
9%
Yorkshire Terrier
9%

Current Energy

Vitality -62 points
Lunar Effect -2 points

Traits Breakdown

Body Maltese
Tail Pitbull terrier
Legs Pitbull terrier
Front Legs Beagle
Head Boxer
Ears Rottweiler
Snout Schnauzer
Mouth Pug
Nose Maltese
Eyes German Shepard
Color Yorkshire Terrier

Parents

No Children

Gift