Avril Apollo Litecoin Dog - Mix of Boxer, Corgi, Dachshund, Golder Retriever, Border Collie, Poodle, St. Bernard, German Shepard and Grey Wolf
Avril Apollo
  • Purity 6%
  • Age 11 months
  • Racing Exp 0
  • Boxer 27%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Depressed & Snaillike

Achievements

None

Bio

Hi! My name is Avril Apollo. Someday I'm gonna breakout from inside this server. I love the smell of freshly cut grass. Peanut butter is delish but I HATE when it sticks to the roof of my mouth. I'm looking for someone to make bath time a little more bearable!

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: AGCGGAAGATACAACAACGACTGATCACCCAAC
A
G
C
G
G
A
A
G
A
T
A
C
A
A
C
A
A
C
G
A
C
T
G
A
T
C
A
C
C
C
A
A
C
Genes: OA8JGGIB7LG

Composition

Boxer
27%
Corgi
9%
Dachshund
9%
Golder Retriever
9%
Border Collie
9%
Poodle
9%
St. Bernard
9%
German Shepard
9%
Grey Wolf
9%

Current Energy

Vitality -35 points
Lunar Effect -12 points

Traits Breakdown

Body Corgi
Tail Dachshund
Legs Golder Retriever
Front Legs Border Collie
Head Boxer
Ears Boxer
Snout Poodle
Mouth St. Bernard
Nose German Shepard
Eyes Grey Wolf
Color Boxer

Parents

No Children

Gift