Zoie Zip Digital Cryptocurrency Dog - Mix of German Shepard, Grey Wolf, Border Collie, Pug, Yorkshire Terrier, Dachshund, Maltese and Schnauzer
Zoie Zip
  • Purity 6%
  • Age 13 months
  • Racing Exp 0
  • German Shepard 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Sad & Tardy

Achievements

None

Bio

Top o' the mornin' to ya! I'm Zoie Zip. I'm into leather...if I have the right partner. I don't like to be ignored. I really enjoy squeaky toys! Well, I like ripping them apart and taking out the squeaker! Rolling around on the carpet after a bath is my favorite way to dry.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TCAGAACCCCCCTTATACGGAACCATATCATAC
T
C
A
G
A
A
C
C
C
C
C
C
T
T
A
T
A
C
G
G
A
A
C
C
A
T
A
T
C
A
T
A
C
Genes: 72LLFJAKC7J

Composition

German Shepard
18%
Grey Wolf
18%
Border Collie
18%
Pug
9%
Yorkshire Terrier
9%
Dachshund
9%
Maltese
9%
Schnauzer
9%

Current Energy

Vitality -13 points
Lunar Effect +2 points

Traits Breakdown

Body German Shepard
Tail Pug
Legs Grey Wolf
Front Legs Grey Wolf
Head Yorkshire Terrier
Ears Border Collie
Snout Dachshund
Mouth Maltese
Nose Schnauzer
Eyes German Shepard
Color Border Collie