Hallie Honda Litecoin Game Dog - Mix of German Shepard, St. Bernard, Beagle, Golder Retriever, Schnauzer, Labrador BK, Maltese, Boxer and Labrador
Hallie Honda
  • Purity 3%
  • Age 9 months
  • Racing Exp 0
  • German Shepard 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Depressed & Snaillike

Achievements

None

Bio

Hallie Honda here, let's shake. I live inside of a web app in a big data center. I love the smell of freshly cut grass. Aggressive dogs that don't let 'me be me' frustrate me. My favorite treat is to steal the pepperoni off of pizza. I want a mate that knows how to give a proper belly rub!

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TCACTATGAAGAATAGCAACCTCAAACTGACCA
T
C
A
C
T
A
T
G
A
A
G
A
A
T
A
G
C
A
A
C
C
T
C
A
A
A
C
T
G
A
C
C
A
Genes: 7DB8C6K7GB5

Composition

German Shepard
18%
St. Bernard
18%
Beagle
9%
Golder Retriever
9%
Schnauzer
9%
Labrador BK
9%
Maltese
9%
Boxer
9%
Labrador
9%

Current Energy

Vitality -25 points
Lunar Effect +10 points

Traits Breakdown

Body German Shepard
Tail Beagle
Legs St. Bernard
Front Legs Golder Retriever
Head Schnauzer
Ears Labrador BK
Snout Maltese
Mouth German Shepard
Nose Boxer
Eyes St. Bernard
Color Labrador

Parents

No Children

Gift