Emmitt Erin Cryptocurrency Game Dog - Mix of Rottweiler, Yorkshire Terrier, German Shepard, Pitbull terrier, St. Bernard, Husky, Border Collie and Labrador
Emmitt Erin
  • Purity 6%
  • Age 6 months
  • Racing Exp 0
  • Rottweiler 27%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Depressed & Snaillike

Achievements

None

Bio

As a digital dog, let me say Bob Dole did not invent the internet. Spiked dog collars really turn me on. Traipsing through mud puddles on to clean carpets...that's my favorite Saturday plan. I don't appreciate being around bores who bark too much. I enjoy going to the dog park to see all my friends!

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TTATCATCCTGAACACACTACCACCCATTACAC
T
T
A
T
C
A
T
C
C
T
G
A
A
C
A
C
A
C
T
A
C
C
A
C
C
C
A
T
T
A
C
A
C
Genes: F7NB4HJH5FH

Composition

Rottweiler
27%
Yorkshire Terrier
18%
German Shepard
9%
Pitbull terrier
9%
St. Bernard
9%
Husky
9%
Border Collie
9%
Labrador
9%

Current Energy

Vitality -35 points
Lunar Effect +8 points

Traits Breakdown

Body Yorkshire Terrier
Tail German Shepard
Legs Pitbull terrier
Front Legs St. Bernard
Head Husky
Ears Rottweiler
Snout Border Collie
Mouth Rottweiler
Nose Labrador
Eyes Yorkshire Terrier
Color Rottweiler

Parents

No Children

Gift