Sadie Sinker Bitcoin Dog - Mix of Labrador, Corgi, Golder Retriever, Border Collie, Pug, St. Bernard and Beagle
Sadie Sinker
  • Purity 9%
  • Age 15 months
  • Racing Exp 0
  • Labrador 27%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Neutral & Tardy

Achievements

None

Bio

Well hello, beautiful. My name's Sadie Sinker. I love licking faces! Little humans are my favorite because they usually have some good food smeared all over them! I'll be honest...Napping is my favorite so we gotta go slow. Getting out of a long relationship, not looking for another

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TACAGCCCAAGAAGACCAAGCCCAGAATGACTA
T
A
C
A
G
C
C
C
A
A
G
A
A
G
A
C
C
A
A
G
C
C
C
A
G
A
A
T
G
A
C
T
A
Genes: JO5885O52BD

Composition

Labrador
27%
Corgi
18%
Golder Retriever
18%
Border Collie
9%
Pug
9%
St. Bernard
9%
Beagle
9%

Current Energy

Vitality -25 points
Lunar Effect 0 points

Traits Breakdown

Body Border Collie
Tail Corgi
Legs Labrador
Front Legs Golder Retriever
Head Golder Retriever
Ears Labrador
Snout Corgi
Mouth Labrador
Nose Pug
Eyes St. Bernard
Color Beagle

Parents

No Children

Gift