Sideline Stitch Bitcoin Game Dog - Mix of Border Collie, Shiba Inu, Beagle, Dachshund, Labrador, Corgi, Schnauzer, Pug and Grey Wolf
Sideline Stitch
  • Purity 3%
  • Age 7 months
  • Racing Exp 6
  • Border Collie 18%
  • Gold medal 0 Silver medal 0 Bronze medal 1
  • 1 races
  • Gen 0
Depressed & Snaillike

Achievements

Racer

Bio

If you'd like to get together, I'm Sideline Stitch. I work hard all day as a data miner on the web, and that pawsitively irritating Nyan Cat doesn't work at all. I don't understand why my human tries to give me tap water. I expect filtered and distilled! I'm looking to share time together and not just to be an accessory.

Racing Stats

Ran 1 races
  • 0 0 1
 Best Time15.72 sec
No rank  RacingĀ *** LTC
100.0 % wins (1) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: CTATACGGATACCCAAGCATAGAAGTACCCGTA
C
T
A
T
A
C
G
G
A
T
A
C
C
C
A
A
G
C
A
T
A
G
A
A
G
T
A
C
C
C
G
T
A
Genes: DJAJ5OC2ELE

Composition

Border Collie
18%
Shiba Inu
18%
Beagle
9%
Dachshund
9%
Labrador
9%
Corgi
9%
Schnauzer
9%
Pug
9%
Grey Wolf
9%

Current Energy

Vitality -45 points
Lunar Effect -4 points

Traits Breakdown

Body Beagle
Tail Border Collie
Legs Dachshund
Front Legs Border Collie
Head Labrador
Ears Corgi
Snout Schnauzer
Mouth Pug
Nose Shiba Inu
Eyes Grey Wolf
Color Shiba Inu