Lollipop Latte Crypto Dog - Mix of Pitbull terrier, Beagle, German Shepard, Maltese, Poodle, Labrador, Corgi, Husky, Dachshund and French Bulldog
Lollipop Latte
  • Purity 1%
  • Age 15 months
  • Racing Exp 1
  • Pitbull terrier 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 1 races
  • Gen 0
Neutral & Tardy

Achievements

Racer

Bio

I am a guard dog for the data warehouse. After introductory sniffing, I like some licking. I've been known to run with bad dogs. I hate it when other dogs pee in my yard! IT'S MY YARD!! My favorite position is doggie style ;)

Racing Stats

Ran 1 races
  • 0 0 0
 Best Time16.93 sec
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: CTATCATCCACCGACCCAAGCACAGGATCCCGA
C
T
A
T
C
A
T
C
C
A
C
C
G
A
C
C
C
A
A
G
C
A
C
A
G
G
A
T
C
C
C
G
A
Genes: D7NKI5O4AN9

Composition

Pitbull terrier
18%
Beagle
9%
German Shepard
9%
Maltese
9%
Poodle
9%
Labrador
9%
Corgi
9%
Husky
9%
Dachshund
9%
French Bulldog
9%

Current Energy

Vitality -65 points
Lunar Effect -8 points

Traits Breakdown

Body Beagle
Tail German Shepard
Legs Pitbull terrier
Front Legs Maltese
Head Poodle
Ears Labrador
Snout Corgi
Mouth Husky
Nose Dachshund
Eyes Pitbull terrier
Color French Bulldog

Parents

No Children

Photos

Gift