Benji Bell Crypto Dog - Mix of Border Collie, Golder Retriever, Schnauzer, Grey Wolf, German Shepard, Maltese, St. Bernard and French Bulldog
Benji Bell
  • Purity 9%
  • Age 6 months
  • Racing Exp 0
  • Border Collie 27%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Ecstatic & Fast

Achievements

None

Bio

Those Elizabethan cone collars are awful! You gotta lick when you gotta lick, am I right? Little Bow Wow is my favorite musician. I just assume he's a dog... I've been known to run with bad dogs. I am a proud show dog. I like showing off my perfect coat!

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: ATACCCTCAACCTACTACTGATACCGAAGAAGA
A
T
A
C
C
C
T
C
A
A
C
C
T
A
C
T
A
C
T
G
A
T
A
C
C
G
A
A
G
A
A
G
A
Genes: CL7KJJBJ988

Composition

Border Collie
27%
Golder Retriever
18%
Schnauzer
9%
Grey Wolf
9%
German Shepard
9%
Maltese
9%
St. Bernard
9%
French Bulldog
9%

Current Energy

Vitality -37 points
Lunar Effect 0 points

Traits Breakdown

Body Schnauzer
Tail Grey Wolf
Legs German Shepard
Front Legs Maltese
Head Border Collie
Ears Border Collie
Snout St. Bernard
Mouth Border Collie
Nose French Bulldog
Eyes Golder Retriever
Color Golder Retriever

Parents

No Children

Gift