Simba Snuffles Bitcoin Dog - Mix of Dachshund, Labrador BK, Pug, Shiba Inu, French Bulldog, Maltese, Beagle, Corgi, Pitbull terrier and German Shepard
Simba Snuffles
  • Purity 1%
  • Age 6 months
  • Racing Exp 23
  • Dachshund 18%
  • Gold medal 1 Silver medal 0 Bronze medal 2
  • 6 races
  • Gen 0
Depressed & Snaillike

Achievements

Racer

Bio

Hi! I'm Simba Snuffles! I believe running along the beach to catch a stick can be nearly orgasmic. I love licking faces! Little humans are my favorite because they usually have some good food smeared all over them! I'd like to find a dawg to hang with, no pressure. We can always make puppies later.

Racing Stats

Ran 6 races
  • 1 0 2
 Best Time14.92 sec
No rank  RacingĀ *** LTC
50.0 % wins (3) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: GCAGAAGTACGAACCCTAAGCGGATCCTCAGGA
G
C
A
G
A
A
G
T
A
C
G
A
A
C
C
C
T
A
A
G
C
G
G
A
T
C
C
T
C
A
G
G
A
Genes: 62E9KDOAN7A

Composition

Dachshund
18%
Labrador BK
9%
Pug
9%
Shiba Inu
9%
French Bulldog
9%
Maltese
9%
Beagle
9%
Corgi
9%
Pitbull terrier
9%
German Shepard
9%

Current Energy

Vitality -43 points
Lunar Effect -4 points

Traits Breakdown

Body Labrador BK
Tail Pug
Legs Shiba Inu
Front Legs French Bulldog
Head Maltese
Ears Beagle
Snout Corgi
Mouth Dachshund
Nose Pitbull terrier
Eyes German Shepard
Color Dachshund