Pogo Paddy Cryptocurrency Dog - Mix of Pug, Labrador BK, Labrador, French Bulldog, Poodle, Border Collie and Yorkshire Terrier
Pogo Paddy
  • Purity 7%
  • Age 9 months
  • Racing Exp 7
  • Pug 27%
  • Gold medal 0 Silver medal 0 Bronze medal 1
  • 2 races
  • Gen 0
Depressed & Snaillike

Achievements

Racer

Bio

I'd like to help you shed your coat, baby. I don't like running outta pee when there are still so many trees. I think swimming is pretty much the most fun thing ever. Pools, lakes, ponds, even slightly large puddles on the sidewalk! I'm trying to find a dog who'll let me stick my nose where I want, whenever I want.

Racing Stats

Ran 2 races
  • 0 0 1
 Best Time14.22 sec
Rank 22  RacingĀ *** LTC
50.0 % wins (1) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: GCACGAGACTACGCACCAGAATTAGAACCAGAA
G
C
A
C
G
A
G
A
C
T
A
C
G
C
A
C
C
A
G
A
A
T
T
A
G
A
A
C
C
A
G
A
A
Genes: 69IJ652F252

Composition

Pug
27%
Labrador BK
18%
Labrador
18%
French Bulldog
9%
Poodle
9%
Border Collie
9%
Yorkshire Terrier
9%

Current Energy

Vitality -23 points
Lunar Effect -4 points

Traits Breakdown

Body Labrador BK
Tail French Bulldog
Legs Poodle
Front Legs Border Collie
Head Labrador BK
Ears Labrador
Snout Pug
Mouth Yorkshire Terrier
Nose Pug
Eyes Labrador
Color Pug

Parents

No Children

Photos

crypto canine racing podium
Gift