Babbles Basil Litecoin Game Dog - Mix of German Shepard, Yorkshire Terrier, St. Bernard, Pitbull terrier, Pug and Corgi
Babbles Basil
  • Purity 13%
  • Age 6 months
  • Racing Exp 0
  • German Shepard 36%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Depressed & Snaillike

Achievements

None

Bio

Here in cyberspace, I ain't got much use for a floppy disc. I prefer lounging around the house. Nothing beats the midday sunbeam on the couch! I don't like running outta pee when there are still so many trees. I'll outrun you for the ball if I can...that's just how I roll.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TCATTATCATCATCCTGATCATGAGAAAGCTTA
T
C
A
T
T
A
T
C
A
T
C
A
T
C
C
T
G
A
T
C
A
T
G
A
G
A
A
A
G
C
T
T
A
Genes: 7F77NB7B2OF

Composition

German Shepard
36%
Yorkshire Terrier
18%
St. Bernard
18%
Pitbull terrier
9%
Pug
9%
Corgi
9%

Current Energy

Vitality -7 points
Lunar Effect +6 points

Traits Breakdown

Body German Shepard
Tail Yorkshire Terrier
Legs German Shepard
Front Legs German Shepard
Head Pitbull terrier
Ears St. Bernard
Snout German Shepard
Mouth St. Bernard
Nose Pug
Eyes Corgi
Color Yorkshire Terrier

Parents

No Children

Gift