Boss Brooke Cryptocurrency Game Dog - Mix of Yorkshire Terrier, Husky, Corgi, French Bulldog, Shiba Inu, Maltese, Border Collie, Rottweiler, Labrador and Beagle
Boss Brooke
  • Purity 3%
  • Age 7 months
  • Racing Exp 0
  • Yorkshire Terrier 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Depressed & Snaillike

Achievements

None

Bio

Hi, I'm Boss Brooke. As a good digital dog, my humans give me virtually everything. I love barking all night when others try to sleep. I hate it when I am not the center of attention. The place I like most in the world is curled up in my human's bed, hogging all the covers!

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: ACAAGCCGAGTATTATTAACCTACCACCCACTA
A
C
A
A
G
C
C
G
A
G
T
A
T
T
A
T
T
A
A
C
C
T
A
C
C
A
C
C
C
A
C
T
A
Genes: 4O9EFFKJH5D

Composition

Yorkshire Terrier
18%
Husky
9%
Corgi
9%
French Bulldog
9%
Shiba Inu
9%
Maltese
9%
Border Collie
9%
Rottweiler
9%
Labrador
9%
Beagle
9%

Current Energy

Vitality -40 points
Lunar Effect -2 points

Traits Breakdown

Body Husky
Tail Corgi
Legs French Bulldog
Front Legs Shiba Inu
Head Yorkshire Terrier
Ears Yorkshire Terrier
Snout Maltese
Mouth Border Collie
Nose Rottweiler
Eyes Labrador
Color Beagle

Parents

No Children

Gift