Wrinkles Wrinkles Litecoin Dog - Mix of Beagle, Dachshund, Grey Wolf, Golder Retriever, Border Collie, Boxer, Poodle and St. Bernard
Wrinkles Wrinkles
  • Purity 6%
  • Age 5 months
  • Racing Exp 0
  • Beagle 27%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Depressed & Snaillike

Achievements

None

Bio

I don't like it when my bowl is empty, so I take it to my human and it magically refills! I'm the best at running circle 8's. I'll lick anything. I think swimming is pretty much the most fun thing ever. Pools, lakes, ponds, even slightly large puddles on the sidewalk! New experiences? New treats? New places! Yes, please!

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: GGACCCCTAAGATACCTAAACGGACTAGACTGA
G
G
A
C
C
C
C
T
A
A
G
A
T
A
C
C
T
A
A
A
C
G
G
A
C
T
A
G
A
C
T
G
A
Genes: ALD8JDGADIB

Composition

Beagle
27%
Dachshund
18%
Grey Wolf
9%
Golder Retriever
9%
Border Collie
9%
Boxer
9%
Poodle
9%
St. Bernard
9%

Current Energy

Vitality -32 points
Lunar Effect -4 points

Traits Breakdown

Body Dachshund
Tail Grey Wolf
Legs Beagle
Front Legs Golder Retriever
Head Border Collie
Ears Beagle
Snout Boxer
Mouth Dachshund
Nose Beagle
Eyes Poodle
Color St. Bernard

Parents

No Children

Gift