Maxwell Mlem Digital Cryptocurrency Dog - Mix of French Bulldog, Golder Retriever, Pug, Poodle, St. Bernard, German Shepard, Husky, Beagle, Yorkshire Terrier and Schnauzer
Maxwell Mlem
  • Purity 1%
  • Age 11 months
  • Racing Exp 0
  • French Bulldog 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Depressed & Snaillike

Achievements

None

Bio

Nice to meet you! I'm Maxwell Mlem. I don't like running outta pee when there are still so many trees. After introductory sniffing, I like some licking. I'm a serial monogamist. My favorite treat is to steal the pepperoni off of pizza. I need someone that "brings home the bacon"!

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: AGAGAACGAGACTGATCAACACGACTATTAATA
A
G
A
G
A
A
C
G
A
G
A
C
T
G
A
T
C
A
A
C
A
C
G
A
C
T
A
T
T
A
A
T
A
Genes: 829IB749DFC

Composition

French Bulldog
18%
Golder Retriever
9%
Pug
9%
Poodle
9%
St. Bernard
9%
German Shepard
9%
Husky
9%
Beagle
9%
Yorkshire Terrier
9%
Schnauzer
9%

Current Energy

Vitality -43 points
Lunar Effect -6 points

Traits Breakdown

Body Golder Retriever
Tail Pug
Legs French Bulldog
Front Legs Poodle
Head St. Bernard
Ears German Shepard
Snout Husky
Mouth French Bulldog
Nose Beagle
Eyes Yorkshire Terrier
Color Schnauzer

Parents

No Children

Gift