Cletus Czar Litecoin Dog - Mix of Golder Retriever, Shiba Inu, Schnauzer, Grey Wolf, Beagle, Corgi, Dachshund, Border Collie and Yorkshire Terrier
Cletus Czar
  • Purity 5%
  • Age 6 months
  • Racing Exp 0
  • Golder Retriever 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Depressed & Snaillike

Achievements

None

Bio

Too much steak gives me the runs! I hate being left alone all day. I love car rides when I can stick my head out the window. When I can break free, I enjoy exploring my neighborhood without my human.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: ATAAGAGTAGTACCCCTAAGCAGAGGATACTTA
A
T
A
A
G
A
G
T
A
G
T
A
C
C
C
C
T
A
A
G
C
A
G
A
G
G
A
T
A
C
T
T
A
Genes: C8EELDO8AJF

Composition

Golder Retriever
18%
Shiba Inu
18%
Schnauzer
9%
Grey Wolf
9%
Beagle
9%
Corgi
9%
Dachshund
9%
Border Collie
9%
Yorkshire Terrier
9%

Current Energy

Vitality -43 points
Lunar Effect 0 points

Traits Breakdown

Body Schnauzer
Tail Golder Retriever
Legs Shiba Inu
Front Legs Shiba Inu
Head Grey Wolf
Ears Beagle
Snout Corgi
Mouth Golder Retriever
Nose Dachshund
Eyes Border Collie
Color Yorkshire Terrier