Jinx Jock Litecoin Dog - Mix of Labrador, Yorkshire Terrier, Rottweiler, Labrador BK, Border Collie, Beagle, Husky and Dachshund
Jinx Jock
  • Purity 6%
  • Age 13 months
  • Racing Exp 0
  • Labrador 27%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Sad & Tardy

Achievements

None

Bio

I keep my well-built figure with zeros and ones. I'll be honest...Napping is my favorite so we gotta go slow. I hate it when I am not the center of attention. I'm into recreational spankings and a little 'ruff' play. Dragging my butt on the carpet feels so good.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: CCACACCCATTAGCATACCCATTACTAACAGGA
C
C
A
C
A
C
C
C
A
T
T
A
G
C
A
T
A
C
C
C
A
T
T
A
C
T
A
A
C
A
G
G
A
Genes: 5H5F6J5FD4A

Composition

Labrador
27%
Yorkshire Terrier
18%
Rottweiler
9%
Labrador BK
9%
Border Collie
9%
Beagle
9%
Husky
9%
Dachshund
9%

Current Energy

Vitality -21 points
Lunar Effect +4 points

Traits Breakdown

Body Labrador
Tail Rottweiler
Legs Labrador
Front Legs Yorkshire Terrier
Head Labrador BK
Ears Border Collie
Snout Labrador
Mouth Yorkshire Terrier
Nose Beagle
Eyes Husky
Color Dachshund

Parents

No Children

Gift