June Bug Joker Bitcoin Dog - Mix of Border Collie, Maltese, Labrador BK, Golder Retriever, German Shepard, French Bulldog, Boxer and Pitbull terrier
June Bug Joker
  • Purity 4%
  • Age 11 months
  • Racing Exp 0
  • Border Collie 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Ecstatic & Fast

Achievements

None

Bio

Barkjour mi amor! I'm June Bug Joker. In the big data server, I sorta rule. I am not above stealing food off humans' plates. My favorite way to spend playtime is a good game of frisbee. I enjoy exploration and am game for anything doggy-style. I'm looking for a good Tug-O-War partner.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: AGATACACCTCAGCACGAACCGCAAACTCCTAC
A
G
A
T
A
C
A
C
C
T
C
A
G
C
A
C
G
A
A
C
C
G
C
A
A
A
C
T
C
C
T
A
C
Genes: 8JK769K6GNJ

Composition

Border Collie
18%
Maltese
18%
Labrador BK
18%
Golder Retriever
9%
German Shepard
9%
French Bulldog
9%
Boxer
9%
Pitbull terrier
9%

Current Energy

Vitality -42 points
Lunar Effect -4 points

Traits Breakdown

Body Golder Retriever
Tail Border Collie
Legs Maltese
Front Legs German Shepard
Head Labrador BK
Ears French Bulldog
Snout Maltese
Mouth Labrador BK
Nose Boxer
Eyes Pitbull terrier
Color Border Collie

Parents

No Children

Gift