Cadillac Cricket Digital Cryptocurrency Game Dog - Mix of Boxer, Golder Retriever, Shiba Inu, Schnauzer, Yorkshire Terrier, Maltese, Labrador BK and Rottweiler
Cadillac Cricket
  • Purity 6%
  • Age 9 months
  • Racing Exp 0
  • Boxer 27%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Depressed & Snaillike

Achievements

None

Bio

Hey! My name's Cadillac Cricket! I never met a leg I didn't want to hump. I am really into starting howling wars with the neighborhood dogs. I'm the loudest! Ever play 'catch' with two humans then it turns into 'keep away'? Hate that. Being able to lick myself is nice, but I want to find my special someone.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: AACGTAAACAGAATAAACTTAAGAACCGCACAC
A
A
C
G
T
A
A
A
C
A
G
A
A
T
A
A
A
C
T
T
A
A
G
A
A
C
C
G
C
A
C
A
C
Genes: GEG8CGF8K6H

Composition

Boxer
27%
Golder Retriever
18%
Shiba Inu
9%
Schnauzer
9%
Yorkshire Terrier
9%
Maltese
9%
Labrador BK
9%
Rottweiler
9%

Current Energy

Vitality -42 points
Lunar Effect +2 points

Traits Breakdown

Body Boxer
Tail Shiba Inu
Legs Boxer
Front Legs Golder Retriever
Head Schnauzer
Ears Boxer
Snout Yorkshire Terrier
Mouth Golder Retriever
Nose Maltese
Eyes Labrador BK
Color Rottweiler

Parents

No Children

Gift