Cricket Chopper Litecoin Dog - Mix of Maltese, Labrador, Corgi, Border Collie, Grey Wolf, Rottweiler, Pug and Poodle
Cricket Chopper
  • Purity 4%
  • Age 7 months
  • Racing Exp 0
  • Maltese 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Depressed & Snaillike

Achievements

None

Bio

The place I like most in the world is curled up in my human's bed, hogging all the covers! I hate it when I am not the center of attention. I've always had a crush on Lassie. I like to play fetch with a tennis ball. Being able to lick myself is nice, but I want to find my special someone.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: ACCTACCCCCACCCAACCAGCGAAAGCCCAGAC
A
C
C
T
A
C
C
C
C
C
A
C
C
C
A
A
C
C
A
G
C
G
A
A
A
G
C
C
C
A
G
A
C
Genes: KJLH5KO2O5I

Composition

Maltese
18%
Labrador
18%
Corgi
18%
Border Collie
9%
Grey Wolf
9%
Rottweiler
9%
Pug
9%
Poodle
9%

Current Energy

Vitality -37 points
Lunar Effect -2 points

Traits Breakdown

Body Maltese
Tail Border Collie
Legs Grey Wolf
Front Legs Rottweiler
Head Labrador
Ears Maltese
Snout Corgi
Mouth Pug
Nose Corgi
Eyes Labrador
Color Poodle

Parents

No Children

Gift