Mother Brain Marky Mark Bitcoin Game Dog - Mix of Pug, Corgi, Boxer, Border Collie, Golder Retriever, Schnauzer, Maltese, Shiba Inu, French Bulldog and St. Bernard
Mother Brain Marky Mark
  • Purity 1%
  • Age 6 months
  • Racing Exp 0
  • Pug 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Depressed & Snaillike

Achievements

None

Bio

I answer to 'Mother Brain Marky Mark'. I work hard all day as a data miner on the web, and that pawsitively irritating Nyan Cat doesn't work at all. I love licking faces! Little humans are my favorite because they usually have some good food smeared all over them! I'm looking for some ruff play. Wanna bite me?

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: AGCAACTACAGAGAAATAACCGTAGAACGATGA
A
G
C
A
A
C
T
A
C
A
G
A
G
A
A
A
T
A
A
C
C
G
T
A
G
A
A
C
G
A
T
G
A
Genes: OGJ82CKE29B

Composition

Pug
18%
Corgi
9%
Boxer
9%
Border Collie
9%
Golder Retriever
9%
Schnauzer
9%
Maltese
9%
Shiba Inu
9%
French Bulldog
9%
St. Bernard
9%

Current Energy

Vitality -27 points
Lunar Effect +4 points

Traits Breakdown

Body Corgi
Tail Boxer
Legs Border Collie
Front Legs Golder Retriever
Head Pug
Ears Schnauzer
Snout Maltese
Mouth Shiba Inu
Nose Pug
Eyes French Bulldog
Color St. Bernard