Peaches Proto Man Crypto Dog - Mix of Pug, Poodle, Schnauzer, Golder Retriever, French Bulldog, Maltese, Boxer, Pitbull terrier, Border Collie and German Shepard
Peaches Proto Man
  • Purity 1%
  • Age 19 months
  • Racing Exp 0
  • Pug 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Sad & Tardy

Achievements

None

Bio

Well hello, beautiful. My name's Peaches Proto Man. My favorite thing to do is go to the pet store with my human. All the other humans pet me and I get to pick out a new toy! I've had my nose rubbed in 'it' more than once. Aggressive dogs that don't let 'me be me' frustrate me.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: GACATAGAAAGACGAACCGAAAACTCCTACTCA
G
A
C
A
T
A
G
A
A
A
G
A
C
G
A
A
C
C
G
A
A
A
A
C
T
C
C
T
A
C
T
C
A
Genes: IC289K2GNJ7

Composition

Pug
18%
Poodle
9%
Schnauzer
9%
Golder Retriever
9%
French Bulldog
9%
Maltese
9%
Boxer
9%
Pitbull terrier
9%
Border Collie
9%
German Shepard
9%

Current Energy

Vitality -42 points
Lunar Effect -4 points

Traits Breakdown

Body Poodle
Tail Schnauzer
Legs Pug
Front Legs Golder Retriever
Head French Bulldog
Ears Maltese
Snout Pug
Mouth Boxer
Nose Pitbull terrier
Eyes Border Collie
Color German Shepard

Parents

No Children

Gift