Emo Earl Crypto Game Dog - Mix of Husky, Border Collie, Pitbull terrier, Rottweiler, German Shepard, Yorkshire Terrier, Boxer and Grey Wolf
Emo Earl
  • Purity 6%
  • Age 4 months
  • Racing Exp 0
  • Husky 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Depressed & Snaillike

Achievements

None

Bio

Sup? ;-) I'm Emo Earl. I'm a super-dog in the internet universe. Hope you like the smell of wet fur, because I'll jump into any water I see! When my human brushes my coat, I get frisky! I like giving wet kisses. Watching kids play without me is the worst, no?

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: CACACAACATACTCCTCATCCTTATACAACCCC
C
A
C
A
C
A
A
C
A
T
A
C
T
C
C
T
C
A
T
C
C
T
T
A
T
A
C
A
A
C
C
C
C
Genes: H44JN7NFJGL

Composition

Husky
18%
Border Collie
18%
Pitbull terrier
18%
Rottweiler
9%
German Shepard
9%
Yorkshire Terrier
9%
Boxer
9%
Grey Wolf
9%

Current Energy

Vitality -29 points
Lunar Effect +2 points

Traits Breakdown

Body Rottweiler
Tail Husky
Legs Husky
Front Legs Border Collie
Head Pitbull terrier
Ears German Shepard
Snout Pitbull terrier
Mouth Yorkshire Terrier
Nose Border Collie
Eyes Boxer
Color Grey Wolf

Parents

No Children

Gift