Binky Boone Crypto Dog - Mix of Corgi, Pug, Pitbull terrier, Rottweiler, Shiba Inu, Maltese, Labrador and Golder Retriever
Binky Boone
  • Purity 4%
  • Age 11 months
  • Racing Exp 0
  • Corgi 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Depressed & Snaillike

Achievements

None

Bio

Hello there, my name is Binky Boone. I've been known to run with bad dogs. Hope you like the smell of wet fur, because I'll jump into any water I see! I really enjoy heavy petting. Power outages and computer viruses scare me!

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: CACGTAAGCACCCCAAGAGAATCCGAAAGCTCC
C
A
C
G
T
A
A
G
C
A
C
C
C
C
A
A
G
A
G
A
A
T
C
C
G
A
A
A
G
C
T
C
C
Genes: HEOK582N2ON

Composition

Corgi
18%
Pug
18%
Pitbull terrier
18%
Rottweiler
9%
Shiba Inu
9%
Maltese
9%
Labrador
9%
Golder Retriever
9%

Current Energy

Vitality -55 points
Lunar Effect 0 points

Traits Breakdown

Body Rottweiler
Tail Shiba Inu
Legs Corgi
Front Legs Maltese
Head Labrador
Ears Golder Retriever
Snout Pug
Mouth Pitbull terrier
Nose Pug
Eyes Corgi
Color Pitbull terrier

Parents

No Children

Gift